-
Successful Fistula Closure After Treatment with Colostomy and Infliximab in a Patient with Ulcerative Colitis Complicated by Rectovaginal Fistula
06 May 2024 08:40 GMT
… . Although mesalazine suppository was added to her drug regimen, … not been randomized controlled trials that support the … and only randomized controlled trial (A Crohn’s … between medical treatment in combination with surgical treatment and surgical treatment …
-
Improving Medication Adherence Levels in Inflammatory Bowel Disease (IBD) Patients: A Narrative Evidence-Based Review
20 Apr 2024 12:31 GMT
… whilst pill counts assess how many pills patients … psychology doctoral candidates delivered the … 30. Pharmaceutical Management Agency (PHARMAC). Achieving Medicine Access Equity … eHealth: individualization of mesalazine treatment through a self-managed …
-
The Efficacy of Chaihu-Guizhi-Ganjiang Decoction on Chronic Non-Atrophic Gastritis with Gallbladder Heat and Spleen Cold Syndrome and Its Metabolomic Analysis: An Observational Controlled Before-After Clinical Trial
21 Mar 2024 09:44 GMT
… medicine (TCM), which provides personalized medical treatment … doctor-patient communication impossible; and 5) taking other drugs … trial was supported by Guangdong Yifang Pharmaceutical Co., LTD., which offered the trial drugs … trial in mesalazine-refractory …
-
Pharmbio Korea secures exclusive rights to distribute Clipper for ulcerative colitis treatment
29 Feb 2024 07:57 GMT
… ), an original ulcerative colitis treatment from Italian pharmaceutical company Chiesi, in Korea … the combination of 5-ASA (mesalazine) and Clipper improved remission induction …
-
CDSCO Drug Alert: 46 Drug Samples Including Sun Pharma's Levipil 500 Flagged
24 Feb 2024 18:42 GMT
… Kolkata
Central Drugs Laboratory, Kolkata
5
Mesalazine Prolonged-release … East Zone, Kolkata
Central Drugs Laboratory, Kolkata
7
… 47;11/2026
Hygeia Pharmaceuticals MFG. (P) Ltd. … North Zone), Ghaziabad
Central Drugs Laboratory, Kolkata
10
Livocitra …
-
Drug Repurposing in Crohn’s Disease Using Danish Real-World Data
21 Feb 2024 08:22 GMT
… drugs reach the pharmaceutical market, leaving patients with limited treatment … medical procedures, and redeemed medications from … IBD therapeutics (azathioprine, mesalazine, sulfasalazine), corticosteroids ( … The influence of antidepressants on the …
-
What Do We Know about Medication Adherence Interventions in Inflammatory Bowel Disease, Multiple Sclerosis and Rheumatoid Arthritis? A Scoping Review of Randomised Controlled Trials
12 Dec 2023 23:58 GMT
… concentration of medication or electronic drug monitoring, … through the NIHR Doctoral Fellowship programme (NIHR302646 … K. Trials and tribulations with electronic medication adherence … eHealth: individualization of mesalazine treatment through a self-managed …
-
Palatin Presents Data at the United European Gastroenterology Week 2023 Conference On PL8177 Ulcerative Colitis Treatment
16 Oct 2023 20:07 GMT
… the positive control mesalazine, PL8177 showed significant … treatment of diseases with significant unmet medical … clinical trials, regulatory actions by the FDA and … by competing pharmaceutical, biopharmaceutical and biotechnology companies, commercial …
-
Treatment of Ulcerative Colitis by Cationic Liposome Delivered NLRP3 siRNA
16 Aug 2023 08:52 GMT
… treatment is available, patients with UC must take life-long medications … ACACATTGGGGGTAGGAACA) (Sangon Biotech, China). RT-PCR … -steroidal anti-inflammatory drugs (mesalazine), glucocorticoids (hydrocortisone), … RNAi-based drugs to the pharmaceutical market. …
-
5-Aminosalicylates Drugs Market Is Projected to increase at a CAGR of around 3.5% during 2023 to 2031: Exclusive report by Growth Plus Reports
25 May 2023 06:57 GMT
… aminosalicylates drugs market is segmented into sulfasalazine, mesalazine, … introduction of new medications for ulcerative … Acute Kidney Injuries), Treatment (Drug Therapy, Dialysis) - … of EPhMRA (European Pharmaceutical Marketing Research Association). …