-
Algae Products Market Size is projected to reach USD 2,833.73 million by 2031, growing at a CAGR of 5.09%: Straits Research
28 Mar 2024 15:45 GMT
… essential nutrients, minerals, and vitamins. Algae products are single-celled … are an excellent source of vitamins A, B1, B2, B6 … , Koninklijke DSM NV, Progress Biotech BV, J.M. Huber … Corporation, Algenol Biotech LLC, and BASF SE. Market …
-
Probiotics Dietary Supplement Market is anticipated to surpass US$9.795 billion by 2029 at a CAGR of 6.08%
28 Mar 2024 12:51 GMT
… AG)
• Lifeway Foods, Inc.
• Kibow Biotech
• Pharmavite LLC (Otsuka Pharmaceutical)
• DSM … report/glutathione-supplement-market
• Vitamin supplements market https:/… .com/report/vitamin-supplements-market
Ankit Mishra
Knowledge …
-
Artificial Tendons and Ligaments Market is growing at a CAGR of 16.8% from 2024 to 2030 by Exactitude Consultancy
28 Mar 2024 10:18 GMT
… , Smith+Nephew, LARS, Neoligaments, Cousin Biotech, FX Solutions, Orthomed S.A … ;21572/predictive-maintenance-market
Vitamin K Market
https:/… /reports/3269/vitamin-k-market/
Forensic Equipment …
-
Paradise may look a little different. . .
28 Mar 2024 00:46 GMT
… a “scientifically tested” regime of vitamin and mineral supplements, calorie restriction … to humans. Loyal is a biotech start-up dedicated to extending …
-
Male Contraceptive Initiative Marks Women’s History Month With Investment in Birth Control Pill for Men
27 Mar 2024 15:18 GMT
… YourChoice Therapeutics, a San Francisco biotech startup, developing the first hormone … acid - a form of vitamin A - in male … have understood for decades that vitamin A is essential for male … retinoic acid, a form of vitamin A). Several preclinical studies have …
-
Ro-Gro unveils ‘industry-first’ B12-fortified pea shoots
27 Mar 2024 11:21 GMT
… ’ pea shoots biofortified with vitamin B12, available this spring … be nutritionally enhanced with vitamins not usually found in … This was the first vitamin to be selected for … including agriculture, engineering and biotechnology can we address some of …
-
IFE 2024: Eye-catching innovations from the show floor
27 Mar 2024 12:19 GMT
… ' biofortified pea shoots, containing vitamin B12.
"We’re excited … industry including agriculture, engineering and biotechnology can we address some of … ) of 1.5 micrograms of vitamin B12.
Gut-friendly breakfast bars …
-
The Association Between Epidermal Growth Factor rs3756261 A/G Gene Polymorphism and the Risk of Ankylosing Spondylitis in a Chinese Han Population
27 Mar 2024 10:58 GMT
… -Plex SNP scanTM Kit (Genesky Biotechnologies Inc., Shanghai, China), which … (forward) and GAAGTGTGATCTGCCCACCT (reverse) (Genesky Biotechnologies Inc., Shanghai, China). About 10% … The relation between osteoporosis and Vitamin D levels and disease activity …
-
Green Synthesis of Zinc Oxide Nanoparticles from Althaea officinalis Flower Extract Coated with Chitosan for Potential Healing Effects on Diabetic Wounds by Inhibiting TNF-α and IL-6/IL-1β Signaling Pathways
27 Mar 2024 10:58 GMT
… Regional Center for Mycology and Biotechnology provided us with standardized bacterial … Eastern folk medicine. Numerous bioflavonoids, vitamins, and antioxidant chemicals can be …
-
Neuropathic Ocular Pain Market Key Players Analysis, Opportunity Assessment and Market Expansion Strategies 2031
27 Mar 2024 10:09 GMT
… INC.
◘ Optocred Pharmaceuticals and BRIM Biotechnology Inc.
By Drug Class: Steroids … Drugs, Antidepressants, Anticonvulsants, Opioids, Others (Vitamin B supplements, Botulinum toxin A …